Detail of EST/Unigene BG583367
Acc. BG583367
Internal Acc. EST485118
Type EST
Annotation (Top 5 hits in Uniprot_trembl) 40S ribosomal protein S19-2 OS=Arabidopsis thaliana E-value=2e-10; 40S ribosomal protein S19-3 OS=Arabidopsis thaliana E-value=3e-10; 40S ribosomal protein S19-1 OS=Arabidopsis thaliana E-value=3e-10; 40S ribosomal protein S19 OS=Oryza sativa subsp. japonica E-value=9e-10; 40S ribosomal protein S19 OS=Branchiostoma belcheri E-value=5e-08;
Length 110 nt
Species Medicago truncatula
Belonged EST Libraries MT_NOD_GVN;
Sequence AACTGCATAATTCAAAGAATTGGCTCCCTATGATCCTGATTGGTATTATGTTAGAGCTGC
TTGCATGGCAAGGAAAATCTACGTAAGAAGCGGTCTTGGTGTTGGTTCAT
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology Genetic Information Processing > Translation > ko03010 Ribosome > K02966 small subunit ribosomal protein S19e
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 831405 
Trichome-related Gene from Literature N/A