Detail of EST/Unigene BG583659 |
Acc. | BG583659 |
Internal Acc. | EST485411 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Alternative oxidase 1, mitochondrial OS=Nicotiana tabacum E-value=3e-64; Alternative oxidase 2, mitochondrial OS=Nicotiana tabacum E-value=4e-64; Alternative oxidase 1a, mitochondrial OS=Arabidopsis thaliana E-value=1e-62; Alternative oxidase 1, mitochondrial OS=Glycine max E-value=1e-58; Alternative oxidase 1b, mitochondrial OS=Arabidopsis thaliana E-value=5e-57; |
Length | 716 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_GVN; |
Sequence | CTAAACAAAACCTAAAACCTCTCTCTCTCTTTCTCTAATATTCTTTCACAAATTCATTCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821806 |
Trichome-related Gene from Literature | N/A |