Detail of EST/Unigene BG588301 |
Acc. | BG588301 |
Internal Acc. | EST490110 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Triticum aestivum E-value=5e-14; Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=1e-12; Glucan endo-1,3-beta-glucosidase 1 OS=Arabidopsis thaliana E-value=1e-09; Glucan endo-1,3-beta-glucosidase 2 OS=Arabidopsis thaliana E-value=7e-09; Glucan endo-1,3-beta-glucosidase 3 OS=Arabidopsis thaliana E-value=2e-08; |
Length | 463 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MHRP-root; |
Sequence | ACAAGCAAATATAAACTATGTTTGCAGCCAAAAGTTGATTGCAGACCAATCCAACCAGGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 3770717 |
Trichome-related Gene from Literature | N/A |