| Detail of EST/Unigene BG588407 |
| Acc. | BG588407 |
| Internal Acc. | EST490216 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Succinate-semialdehyde dehydrogenase (acetylating) OS=Metallosphaera sedula (strain ATCC 51363 / DSM 5348) E-value=4e-28; S-(hydroxymethyl)glutathione dehydrogenase OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=2e-18; Alcohol dehydrogenase B OS=Mycobacterium tuberculosis E-value=7e-18; Alcohol dehydrogenase B OS=Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97) E-value=7e-18; Alcohol dehydrogenase class-3 OS=Oryctolagus cuniculus E-value=2e-17; |
| Length | 515 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MHRP-root; |
| Sequence | CCGTTTTCAAGTCCTTGTGTTGAGGGCCATGAGATTACTGGTGAAGTTGTTGAACATGGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00624 1- and 2-Methylnaphthalene degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00641 3-Chloroacrylic acid degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00001 alcohol dehydrogenase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00001 alcohol dehydrogenase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 |
| EC | 1.1.1.1 1.1.1.284 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 836482 |
| Trichome-related Gene from Literature | N/A |