Detail of EST/Unigene BG588484 |
Acc. | BG588484 |
Internal Acc. | EST490293 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 1,4-alpha-glucan-branching enzyme 2-1, chloroplastic/amyloplastic OS=Arabidopsis thaliana E-value=4e-25; 1,4-alpha-glucan-branching enzyme 2-2, chloroplastic/amyloplastic OS=Arabidopsis thaliana E-value=3e-24; 1,4-alpha-glucan-branching enzyme 2, chloroplastic/amyloplastic OS=Zea mays E-value=1e-18; 1,4-alpha-glucan-branching enzyme OS=Mus musculus E-value=5e-12; 1,4-alpha-glucan-branching enzyme OS=Homo sapiens E-value=7e-12; |
Length | 659 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MHRP-root; |
Sequence | GTTATTCAGATTACAAAGTTGGCTGTTTAAAGCCAGGGAAATATAAGATTGTCTTGGATT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00700 1,4-alpha-glucan branching enzyme |
EC | 2.4.1.18 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818212 |
Trichome-related Gene from Literature | N/A |