Detail of EST/Unigene BG588814 |
Acc. | BG588814 |
Internal Acc. | EST490623 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Bifunctional polymyxin resistance protein ArnA OS=Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578) E-value=5e-22; Bifunctional polymyxin resistance protein ArnA OS=Proteus mirabilis (strain HI4320) E-value=6e-22; Bifunctional polymyxin resistance protein ArnA OS=Klebsiella pneumoniae (strain 342) E-value=6e-22; Bifunctional polymyxin resistance protein ArnA OS=Yersinia enterocolitica serotype O:8 / biotype 1B (strain 8081) E-value=8e-22; Bifunctional polymyxin resistance protein ArnA OS=Erwinia carotovora subsp. atroseptica (strain SCRI 1043 / ATCC BAA-672) E-value=1e-21; |
Length | 771 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MHRP-root; |
Sequence | CAGACGGACAAGTGAGGGTGTTCCCCGTGTTCTTGCATGCTTCAGCAATAATCTTCTTAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Carbohydrate Metabolism > ko00520 Nucleotide sugars metabolism > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko01055 Biosynthesis of vancomycin group antibiotics > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko00523 Polyketide sugar unit biosynthesis > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Carbohydrate Metabolism > ko00520 Nucleotide sugars metabolism > K08678 UDP-glucuronate decarboxylase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K08678 UDP-glucuronate decarboxylase |
EC | 4.1.1.35 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837341 |
Trichome-related Gene from Literature | N/A |