Detail of EST/Unigene BG588842 |
Acc. | BG588842 |
Internal Acc. | EST490651 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | SKP1-like protein 1B OS=Arabidopsis thaliana E-value=3e-61; SKP1-like protein 1A OS=Arabidopsis thaliana E-value=2e-59; SKP1-like protein 4 OS=Arabidopsis thaliana E-value=7e-53; SKP1-like protein 11 OS=Arabidopsis thaliana E-value=4e-51; SKP1-like protein 3 OS=Arabidopsis thaliana E-value=4e-50; |
Length | 809 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MHRP-root; |
Sequence | GGTTAGCGATTTACAAACACCGTTTCCAAATTCTCATCCAAACCCTAATCAATCACGATC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03094 S-phase kinase-associated protein 1; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K03094 S-phase kinase-associated protein 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K03094 S-phase kinase-associated protein 1 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 834224 |
Trichome-related Gene from Literature | N/A |