| Detail of EST/Unigene BG604167 |
| Acc. | BG604167 |
| Internal Acc. | EST456173 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=6e-13; Chlorophyll a-b binding protein, chloroplastic (Fragment) OS=Glycine max E-value=6e-13; Chlorophyll a-b binding protein of LHCII type I, chloroplastic (Fragment) OS=Cucumis sativus E-value=6e-13; Chlorophyll a-b binding protein 1, chloroplastic OS=Zea mays E-value=1e-12; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=5e-12; |
| Length | 102 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL; |
| Sequence | CTCCTCAGGAAGCCCATGGTACGGTCCAAACCGTGTTAAGTACTTAGGCCCATTCTCTGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818005 |
| Trichome-related Gene from Literature | N/A |