Detail of EST/Unigene BG644359 |
Acc. | BG644359 |
Internal Acc. | EST505978 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glyoxylate reductase OS=Thermococcus litoralis E-value=1e-16; Glyoxylate reductase OS=Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3) E-value=7e-16; Glyoxylate reductase OS=Pyrococcus kodakaraensis (strain ATCC BAA-918 / JCM 12380 / KOD1) E-value=3e-15; Glyoxylate reductase OS=Pyrococcus abyssi (strain GE5 / Orsay) E-value=1e-14; Glyoxylate reductase OS=Thermococcus gammatolerans (strain DSM 15229 / JCM 11827 / EJ3) E-value=2e-14; |
Length | 526 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3 (1 ESTs); |
Sequence | GAGTCGTCGGAAACGCAACAATCGGGGCTAATGCGGAGTTAATCGGAGTATTACCGAAGC |
EST members of Unigene | BG644359 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00630 Glyoxylate and dicarboxylate metabolism > K00015 glyoxylate reductase; Metabolism > Carbohydrate Metabolism > ko00630 Glyoxylate and dicarboxylate metabolism > K00049 glyoxylate reductase (NADP+); Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00049 glyoxylate reductase (NADP+) |
EC | 1.1.1.26 1.1.1.79 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.28346.1.S1_at
|
Corresponding NCBI Gene | 844326 |
Trichome-related Gene from Literature | N/A |