Detail of EST/Unigene BG644368 |
Acc. | BG644368 |
Internal Acc. | EST505987 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | DNA ligase 1 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=1e-30; DNA ligase 1 OS=Dictyostelium discoideum E-value=3e-30; DNA ligase 1 OS=Arabidopsis thaliana E-value=3e-27; DNA ligase 1 OS=Caenorhabditis elegans E-value=3e-27; DNA ligase 1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=7e-27; |
Length | 612 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3 (1 ESTs); |
Sequence | CAAATATGATGGTCAGCGAGCTCAGATTCATAAACTGTCTGATGGTTCAGTTCGTGTATT |
EST members of Unigene | BG644368 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03410 Base excision repair > K10747 DNA ligase 1; Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K10747 DNA ligase 1; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K10747 DNA ligase 1; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10747 DNA ligase 1 |
EC | 6.5.1.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.28351.1.S1_at
|
Corresponding NCBI Gene | 842991 |
Trichome-related Gene from Literature | N/A |