Detail of EST/Unigene BG644398 |
Acc. | BG644398 |
Internal Acc. | EST506017 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable methionine--tRNA ligase OS=Arabidopsis thaliana E-value=3e-67; Probable methionine--tRNA ligase OS=Oryza sativa subsp. japonica E-value=3e-63; Probable methionine--tRNA ligase, cytoplasmic OS=Dictyostelium discoideum E-value=3e-47; Methionine--tRNA ligase, cytoplasmic OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=9e-47; Probable methionine--tRNA ligase, cytoplasmic OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=5e-46; |
Length | 603 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3 (1 ESTs); |
Sequence | GCTTTGCCGTATGTCAACCAACGTTCCTCATCTCGGAAACATCATCGGAAGTGTGTTGAG |
EST members of Unigene | BG644398 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K01874 methionyl-tRNA synthetase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01874 methionyl-tRNA synthetase; Genetic Information Processing > Translation > ko00970 Aminoacyl-tRNA biosynthesis > K01874 methionyl-tRNA synthetase |
EC | 6.1.1.10 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.2414.1.S1_at
|
Corresponding NCBI Gene | 827012 |
Trichome-related Gene from Literature | N/A |