| Detail of EST/Unigene BG644693 |
| Acc. | BG644693 |
| Internal Acc. | EST506312 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | RNA-directed DNA polymerase homolog OS=Oenothera berteriana E-value=5e-25; Retrotransposable element Tf2 155 kDa protein type 1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=8e-23; Retrotransposable element Tf2 155 kDa protein type 3 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=5e-22; Retrotransposable element Tf2 155 kDa protein type 2 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=5e-22; Retrovirus-related Pol polyprotein from transposon 297 OS=Drosophila melanogaster E-value=2e-21; |
| Length | 716 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SEEDROOT_KV3 (1 ESTs); |
| Sequence | TGATCACCTTCTATAAGTTCCTCCCGAATGGAAAATTGACTTTGGTATTGATTTGTTACC |
| EST members of Unigene | BG644693 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K00272 D-aspartate oxidase; Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03364 cell division cycle 20-like protein 1, cofactor of APC complex; Environmental Information Processing > Signaling Molecules and Interaction > ko04060 Cytokine-cytokine receptor interaction > K04180 chemokine (C-C motif) receptor 5 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.28383.1.S1_at
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |