| Detail of EST/Unigene BG646286 |
| Acc. | BG646286 |
| Internal Acc. | EST507905 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, chloroplastic OS=Glycine max E-value=3e-18; Omega-3 fatty acid desaturase, chloroplastic (Fragment) OS=Brassica napus E-value=2e-16; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=4e-14; Temperature-sensitive omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=2e-13; Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=4e-13; |
| Length | 307 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_HOGA; |
| Sequence | AGGTTTTGCTGTGTCCAACAATTCAGATGCTAAATTTTTAAGCACTAACAAAGAAGTAAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820288 |
| Trichome-related Gene from Literature | 820288 |