Detail of EST/Unigene BG646606 |
Acc. | BG646606 |
Internal Acc. | EST508225 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Mannosyl-oligosaccharide 1,2-alpha-mannosidase MNS3 OS=Arabidopsis thaliana E-value=1e-75; Endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=6e-34; Mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Candida albicans E-value=2e-30; Mannosyl-oligosaccharide 1,2-alpha-mannosidase MNS1 OS=Arabidopsis thaliana E-value=4e-28; Endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Rattus norvegicus E-value=4e-28; |
Length | 703 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_HOGA; |
Sequence | GTGAAGTTTGTTGCCGAAGCAGGATTGTGGGTTGAAGAACACCTTTCTGAGAGAATTAGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Glycan Biosynthesis and Metabolism > ko01030 Glycan structures - Biosynthesis 1 > K01230 mannosyl-oligosaccharide alpha-1,2-mannosidase; Metabolism > Glycan Biosynthesis and Metabolism > ko00513 High-mannose type N-glycan biosynthesis > K01230 mannosyl-oligosaccharide alpha-1,2-mannosidase; Metabolism > Glycan Biosynthesis and Metabolism > ko00510 N-Glycan biosynthesis > K01230 mannosyl-oligosaccharide alpha-1,2-mannosidase |
EC | 3.2.1.113 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839879 |
Trichome-related Gene from Literature | N/A |