| Detail of EST/Unigene BG647182 |
| Acc. | BG647182 |
| Internal Acc. | EST508801 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | O-succinylhomoserine sulfhydrylase OS=Pseudomonas aeruginosa (strain ATCC 15692 / PAO1 / 1C / PRS 101 / LMG 12228) E-value=9e-26; Methionine gamma-lyase OS=Pseudomonas putida E-value=2e-23; Cystathionine gamma-lyase OS=Bacillus subtilis (strain 168) E-value=2e-23; O-acetylhomoserine (thiol)-lyase OS=Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139) E-value=3e-22; Protein MET17 OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) E-value=1e-21; |
| Length | 777 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_HOGA; |
| Sequence | TTGTAATACTAATCACCACTTAACTCCCTTCTCCTACACACTAAACCCATGGCTGACACT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01758 cystathionine gamma-lyase; Metabolism > Amino Acid Metabolism > ko00272 Cysteine metabolism > K01758 cystathionine gamma-lyase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K01758 cystathionine gamma-lyase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K01758 cystathionine gamma-lyase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01758 cystathionine gamma-lyase |
| EC | 4.4.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842774 |
| Trichome-related Gene from Literature | N/A |