Detail of EST/Unigene BG647373 |
Acc. | BG647373 |
Internal Acc. | EST508992 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | ATP sulfurylase 1, chloroplastic OS=Arabidopsis thaliana E-value=0; ATP sulfurylase 4, chloroplastic OS=Arabidopsis thaliana E-value=3e-97; ATP-sulfurylase 3, chloroplastic OS=Arabidopsis thaliana E-value=1e-93; ATP sulfurylase 2 OS=Arabidopsis thaliana E-value=2e-87; Bifunctional 3'-phosphoadenosine 5'-phosphosulfate synthase 1 OS=Cavia porcellus E-value=4e-55; |
Length | 694 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_HOGA; |
Sequence | GAGGCTTCGAGTTTCCTCCGGTTTGATTGAACCGGATGGTGGAAAATTGGTGGAGCTTGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00920 Sulfur metabolism > K00860 adenylylsulfate kinase; Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K00860 adenylylsulfate kinase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K00860 adenylylsulfate kinase; Metabolism > Energy Metabolism > ko00920 Sulfur metabolism > K00958 sulfate adenylyltransferase; Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K00958 sulfate adenylyltransferase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K00958 sulfate adenylyltransferase |
EC | 2.7.1.25 2.7.7.4 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821861 |
Trichome-related Gene from Literature | N/A |