Detail of EST/Unigene BG647442 |
Acc. | BG647442 |
Internal Acc. | EST509061 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Heat shock 22 kDa protein, mitochondrial OS=Pisum sativum E-value=1e-49; 23.6 kDa heat shock protein, mitochondrial OS=Arabidopsis thaliana E-value=2e-34; Small heat shock protein, chloroplastic OS=Chenopodium rubrum E-value=6e-28; 23.5 kDa heat shock protein, mitochondrial OS=Arabidopsis thaliana E-value=1e-27; Heat shock 22 kDa protein, mitochondrial OS=Glycine max E-value=7e-26; |
Length | 704 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_HOGA; |
Sequence | TTCTCCTCAGGCCTCCTCTCCAGGTCTCTCCGTCCTGTTGCCTCTTCCGCTTCCCGTTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828623 |
Trichome-related Gene from Literature | N/A |