| Detail of EST/Unigene BG647486 |
| Acc. | BG647486 |
| Internal Acc. | EST509105 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Serine/threonine-protein kinase OXI1 OS=Arabidopsis thaliana E-value=3e-51; SNF1-related protein kinase regulatory subunit gamma-1 OS=Arabidopsis thaliana E-value=1e-35; Phototropin-1B OS=Oryza sativa subsp. japonica E-value=6e-29; Phototropin-1A OS=Oryza sativa subsp. japonica E-value=6e-29; Phototropin-2 OS=Arabidopsis thaliana E-value=5e-28; |
| Length | 724 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_HOGA; |
| Sequence | GGGAGTAATGGCAATGGCTACAATGAGAGAGATGCCAAGGAGCCCTGAAGCCAAACTTGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04373 p90 ribosomal S6 kinase; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04373 p90 ribosomal S6 kinase; Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04688 p70 ribosomal S6 kinase; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04688 p70 ribosomal S6 kinase; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K04688 p70 ribosomal S6 kinase |
| EC | 2.7.11.1 |
| Transcription Factor Family | WRKY |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822119 |
| Trichome-related Gene from Literature | 822119 |