Detail of EST/Unigene BG647486 |
Acc. | BG647486 |
Internal Acc. | EST509105 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Serine/threonine-protein kinase OXI1 OS=Arabidopsis thaliana E-value=3e-51; SNF1-related protein kinase regulatory subunit gamma-1 OS=Arabidopsis thaliana E-value=1e-35; Phototropin-1B OS=Oryza sativa subsp. japonica E-value=6e-29; Phototropin-1A OS=Oryza sativa subsp. japonica E-value=6e-29; Phototropin-2 OS=Arabidopsis thaliana E-value=5e-28; |
Length | 724 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_HOGA; |
Sequence | GGGAGTAATGGCAATGGCTACAATGAGAGAGATGCCAAGGAGCCCTGAAGCCAAACTTGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04373 p90 ribosomal S6 kinase; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04373 p90 ribosomal S6 kinase; Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04688 p70 ribosomal S6 kinase; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04688 p70 ribosomal S6 kinase; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K04688 p70 ribosomal S6 kinase |
EC | 2.7.11.1 |
Transcription Factor Family | WRKY |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822119 |
Trichome-related Gene from Literature | 822119 |