Detail of EST/Unigene BG647552 |
Acc. | BG647552 |
Internal Acc. | EST509171 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Lon protease homolog 1, mitochondrial OS=Arabidopsis thaliana E-value=7e-66; Lon protease homolog 4, chloroplastic/mitochondrial OS=Arabidopsis thaliana E-value=2e-64; Lon protease homolog, mitochondrial OS=Oryza sativa subsp. indica E-value=2e-64; Lon protease homolog, mitochondrial OS=Oryza sativa subsp. japonica E-value=3e-64; Lon protease homolog 3, mitochondrial OS=Arabidopsis thaliana E-value=1e-63; |
Length | 702 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_HOGA; |
Sequence | CCGTGTTGATAGAGAGTGGCAATTCTGAAATACCAATGAAAACGCTAAACTTGATGAGAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.4.21.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 832744 |
Trichome-related Gene from Literature | N/A |