Detail of EST/Unigene BG647751 |
Acc. | BG647751 |
Internal Acc. | EST509370 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Small heat shock protein, chloroplastic OS=Pisum sativum E-value=6e-79; Small heat shock protein, chloroplastic (Fragment) OS=Glycine max E-value=9e-64; Small heat shock protein, chloroplastic OS=Petunia hybrida E-value=7e-61; Small heat shock protein, chloroplastic OS=Solanum lycopersicum E-value=8e-57; 25.3 kDa heat shock protein, chloroplastic OS=Arabidopsis thaliana E-value=3e-51; |
Length | 710 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_HOGA; |
Sequence | GCAAGCTACTAATCTTTGTTGTTAATTGTTTCATTTCTTCATCCTTTTTCTACTCTACTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828881 |
Trichome-related Gene from Literature | N/A |