| Detail of EST/Unigene BG648023 |
| Acc. | BG648023 |
| Internal Acc. | EST509642 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 2-hydroxyisoflavanone synthase OS=Glycine max E-value=0; Licodione synthase OS=Glycyrrhiza echinata E-value=8e-60; Cytochrome P450 93A1 OS=Glycine max E-value=5e-41; Cytochrome P450 93A3 OS=Glycine max E-value=1e-37; Cytochrome P450 93A2 OS=Glycine max E-value=2e-37; |
| Length | 702 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_HOGA; |
| Sequence | TACTTCCTTTAACACAGGTTCCAAACCTCTGCTATTAGTCGTCTTACCTATGACAACTCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00498 cytochrome P450, family 11, subfamily A (cholesterol monooxygenase (side-chain-cleaving)); Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00513 cytochrome P450, family 21, subfamily A (steroid 21-monooxygenase); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
| EC | 1.14.14.1 1.14.99.10 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 841474 |
| Trichome-related Gene from Literature | N/A |