Detail of EST/Unigene BG648444 |
Acc. | BG648444 |
Internal Acc. | EST510063 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 14 OS=Arabidopsis thaliana E-value=5e-61; Probable beta-1,3-galactosyltransferase 13 OS=Arabidopsis thaliana E-value=9e-60; Probable beta-1,3-galactosyltransferase 12 OS=Arabidopsis thaliana E-value=2e-48; Probable beta-1,3-galactosyltransferase 5 OS=Arabidopsis thaliana E-value=1e-20; Beta-1,3-galactosyltransferase 7 OS=Arabidopsis thaliana E-value=2e-19; |
Length | 657 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_HOGA; |
Sequence | TCCATGAGCTAAGCCATTATTTACGATGATGCCAAACAAGTACTCCTCCAAGTTTCACGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841763 |
Trichome-related Gene from Literature | N/A |