Detail of EST/Unigene BG648624 |
Acc. | BG648624 |
Internal Acc. | EST510243 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Peroxisomal acyl-coenzyme A oxidase 1 OS=Arabidopsis thaliana E-value=4e-91; Putative peroxisomal acyl-coenzyme A oxidase 1.2 OS=Arabidopsis thaliana E-value=2e-86; Peroxisomal acyl-coenzyme A oxidase 1 OS=Phascolarctos cinereus E-value=7e-39; Peroxisomal acyl-coenzyme A oxidase 1 OS=Cavia porcellus E-value=1e-37; Peroxisomal acyl-coenzyme A oxidase 1 OS=Rattus norvegicus E-value=2e-37; |
Length | 791 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_HOGA; |
Sequence | GATACTCCACAAATAATGAATTAAATTTGGACCAAAGTTTGAAAAGAAAAAATCAAACGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00592 alpha-Linolenic acid metabolism > K00232 acyl-CoA oxidase; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K00232 acyl-CoA oxidase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00232 acyl-CoA oxidase |
EC | 1.3.3.6 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827381 |
Trichome-related Gene from Literature | N/A |