Detail of EST/Unigene BG648648 |
Acc. | BG648648 |
Internal Acc. | EST510267 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Putative aconitate hydratase, cytoplasmic OS=Oryza sativa subsp. japonica E-value=0; Aconitate hydratase, cytoplasmic OS=Cucurbita maxima E-value=0; Aconitate hydratase 2, mitochondrial OS=Arabidopsis thaliana E-value=0; Aconitate hydratase, cytoplasmic (Fragment) OS=Solanum tuberosum E-value=0; Aconitate hydratase 1 OS=Arabidopsis thaliana E-value=4e-98; |
Length | 757 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_HOGA; |
Sequence | AACAAGGGACAGTCCTGCTGCACAATACCTTATGCAGCGTGGGGTGGAAAAGAAGGACTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00020 Citrate cycle (TCA cycle) > K01681 aconitate hydratase 1; Metabolism > Carbohydrate Metabolism > ko00630 Glyoxylate and dicarboxylate metabolism > K01681 aconitate hydratase 1; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01681 aconitate hydratase 1 |
EC | 4.2.1.3 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 815120 |
Trichome-related Gene from Literature | N/A |