Detail of EST/Unigene BG649037 |
Acc. | BG649037 |
Internal Acc. | EST510656 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 76C2 OS=Arabidopsis thaliana E-value=7e-65; Cytochrome P450 71A1 OS=Persea americana E-value=7e-65; Cytochrome P450 76C4 OS=Arabidopsis thaliana E-value=4e-64; Cytochrome P450 98A1 OS=Sorghum bicolor E-value=3e-59; Cytochrome P450 76C1 OS=Arabidopsis thaliana E-value=4e-59; |
Length | 720 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_HOGA; |
Sequence | GGTTTATGGAACATGTATTGGAAGAACACATTGAAAGAAGAAAATGTGAAGGATTATGTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07422 cytochrome P450, family 2, subfamily U |
EC | 1.14.99.9 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819165 |
Trichome-related Gene from Literature | N/A |