| Detail of EST/Unigene BI204438 |
| Acc. | BI204438 |
| Internal Acc. | EST522478 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 724B1 OS=Oryza sativa subsp. japonica E-value=2e-50; Cytochrome P450 90B1 OS=Arabidopsis thaliana E-value=6e-42; 3-epi-6-deoxocathasterone 23-monooxygenase OS=Arabidopsis thaliana E-value=2e-33; Cytochrome P450 90D2 OS=Oryza sativa subsp. japonica E-value=4e-32; 3-epi-6-deoxocathasterone 23-monooxygenase OS=Arabidopsis thaliana E-value=4e-32; |
| Length | 621 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_cTOS (1 ESTs); |
| Sequence | AAGATGGACTTCACTCAAAAGGTAATAAATGAAGCTTTAAGATATGGGAATGTTGTCAAA |
| EST members of Unigene | BI204438 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00232 Caffeine metabolism > K07411 cytochrome P450, family 2, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07411 cytochrome P450, family 2, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K07411 cytochrome P450, family 2, subfamily A; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07411 cytochrome P450, family 2, subfamily A |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824229 |
| Trichome-related Gene from Literature | 824229 |