| Detail of EST/Unigene BI263359 |
| Acc. | BI263359 |
| Internal Acc. | NF089F09PL1F1079 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Superoxide dismutase [Mn], mitochondrial OS=Oryza sativa subsp. japonica E-value=1e-42; Superoxide dismutase [Mn], mitochondrial OS=Rattus norvegicus E-value=1e-41; Superoxide dismutase [Mn] 3.1, mitochondrial OS=Zea mays E-value=3e-41; Superoxide dismutase [Mn], mitochondrial OS=Pongo pygmaeus E-value=3e-41; Superoxide dismutase [Mn], mitochondrial OS=Hylobates lar E-value=4e-41; |
| Length | 657 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF (1 ESTs); |
| Sequence | GACATCATCGTCAATTGCACTATCACAAGCTTGCCTATAATACTCTTCAAAATGGCTTCC |
| EST members of Unigene | BI263359 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 1.15.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.33669.1.S1_at
|
| Corresponding NCBI Gene | 820263 |
| Trichome-related Gene from Literature | N/A |