| Detail of EST/Unigene BI263584 |
| Acc. | BI263584 |
| Internal Acc. | NF086G07PL1F1056 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Alcohol dehydrogenase 1 OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) E-value=8e-83; Alcohol dehydrogenase 1 OS=Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / NRRL 3357 / JCM 12722 / SRRC 167) E-value=1e-74; Alcohol dehydrogenase 1 OS=Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139) E-value=2e-70; Alcohol dehydrogenase 3 OS=Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139) E-value=2e-70; Alcohol dehydrogenase 3, mitochondrial OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) E-value=1e-65; |
| Length | 675 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF (1 ESTs); |
| Sequence | AACCTTTCGATACCCTTCCAACCAAACAACCAACCAACCACTCCAACAATCAAAATGGCC |
| EST members of Unigene | BI263584 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00624 1- and 2-Methylnaphthalene degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00641 3-Chloroacrylic acid degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00001 alcohol dehydrogenase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00001 alcohol dehydrogenase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 |
| EC | 1.1.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.33671.1.S1_at
|
| Corresponding NCBI Gene | 829954 |
| Trichome-related Gene from Literature | 829954 |