| Detail of EST/Unigene BI264978 |
| Acc. | BI264978 |
| Internal Acc. | NF004F02IN1F1027 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Isocitrate dehydrogenase [NADP] cytoplasmic OS=Rattus norvegicus E-value=6e-37; Isocitrate dehydrogenase [NADP] cytoplasmic OS=Mus musculus E-value=6e-37; Isocitrate dehydrogenase [NADP] cytoplasmic OS=Microtus ochrogaster E-value=6e-37; Isocitrate dehydrogenase [NADP] cytoplasmic OS=Microtus mexicanus E-value=6e-37; Isocitrate dehydrogenase [NADP] cytoplasmic OS=Pongo abelii E-value=2e-36; |
| Length | 404 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT (1 ESTs); |
| Sequence | GTTGACGTGCGTGTGACGTAAACACTGTCATCGAAGGTACAGTCTACCGCCCGGNTAATA |
| EST members of Unigene | BI264978 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00020 Citrate cycle (TCA cycle) > K00031 isocitrate dehydrogenase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K00031 isocitrate dehydrogenase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00031 isocitrate dehydrogenase |
| EC | 1.1.1.42 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.33698.1.S1_at
|
| Corresponding NCBI Gene | 831311 |
| Trichome-related Gene from Literature | N/A |