Detail of EST/Unigene BI264978 |
Acc. | BI264978 |
Internal Acc. | NF004F02IN1F1027 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Isocitrate dehydrogenase [NADP] cytoplasmic OS=Rattus norvegicus E-value=6e-37; Isocitrate dehydrogenase [NADP] cytoplasmic OS=Mus musculus E-value=6e-37; Isocitrate dehydrogenase [NADP] cytoplasmic OS=Microtus ochrogaster E-value=6e-37; Isocitrate dehydrogenase [NADP] cytoplasmic OS=Microtus mexicanus E-value=6e-37; Isocitrate dehydrogenase [NADP] cytoplasmic OS=Pongo abelii E-value=2e-36; |
Length | 404 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT (1 ESTs); |
Sequence | GTTGACGTGCGTGTGACGTAAACACTGTCATCGAAGGTACAGTCTACCGCCCGGNTAATA |
EST members of Unigene | BI264978 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00020 Citrate cycle (TCA cycle) > K00031 isocitrate dehydrogenase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K00031 isocitrate dehydrogenase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00031 isocitrate dehydrogenase |
EC | 1.1.1.42 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.33698.1.S1_at
|
Corresponding NCBI Gene | 831311 |
Trichome-related Gene from Literature | N/A |