Detail of EST/Unigene BI268411 |
Acc. | BI268411 |
Internal Acc. | NF004E03GS1F1022 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Inosine triphosphate pyrophosphatase OS=Vitis vinifera E-value=3e-54; Inosine triphosphate pyrophosphatase OS=Arabidopsis thaliana E-value=2e-50; Inosine triphosphate pyrophosphatase OS=Sorghum bicolor E-value=2e-49; Inosine triphosphate pyrophosphatase OS=Oryza sativa subsp. japonica E-value=2e-48; Inosine triphosphate pyrophosphatase OS=Oryza sativa subsp. indica E-value=2e-48; |
Length | 313 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED; |
Sequence | TTTGGCTGCTATTCAGGTTAAAGGACCTGTTTTGGTTGAAGACACTTGCCTCTGTTTCAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K01519 nucleoside-triphosphate pyrophosphatase; Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K01519 nucleoside-triphosphate pyrophosphatase; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K01519 nucleoside-triphosphate pyrophosphatase |
EC | 3.6.1.19 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827006 |
Trichome-related Gene from Literature | N/A |