Detail of EST/Unigene BI269028 |
Acc. | BI269028 |
Internal Acc. | NF001B08IR1F1064 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione S-transferase OS=Glycine max E-value=6e-31; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=6e-31; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=1e-30; Glutathione S-transferase U7 OS=Arabidopsis thaliana E-value=1e-30; Glutathione S-transferase U25 OS=Arabidopsis thaliana E-value=3e-30; |
Length | 591 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA; |
Sequence | ATACACAAGAAGACTCCAGTGTTGGTTCATGATGGAAAACCCATATGCGAGTCAATGATC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817491 |
Trichome-related Gene from Literature | N/A |