Detail of EST/Unigene BI269076 |
Acc. | BI269076 |
Internal Acc. | NF006C07IR1F1053 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | NAD(P)H-dependent 6'-deoxychalcone synthase OS=Glycine max E-value=1e-51; Non-functional NADPH-dependent codeinone reductase 2 OS=Papaver somniferum E-value=2e-24; NADPH-dependent codeinone reductase 1-1 OS=Papaver somniferum E-value=9e-24; NADPH-dependent codeinone reductase 1-4 OS=Papaver somniferum E-value=1e-23; NADPH-dependent codeinone reductase 1-5 OS=Papaver somniferum E-value=5e-23; |
Length | 485 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA; |
Sequence | AAGAAGCTTAGAGAGTTTTGCAACGCAAACGGAATAGTGTTAACTGCATTTTCACCATTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00930 Caprolactam degradation > K00002 alcohol dehydrogenase (NADP+); Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00002 alcohol dehydrogenase (NADP+); Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00002 alcohol dehydrogenase (NADP+); ; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00251 3-oxo-5beta-steroid 4-dehydrogenase; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K00251 3-oxo-5beta-steroid 4-dehydrogenase; Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00251 3-oxo-5beta-steroid 4-dehydrogenase |
EC | 1.1.1.- 1.1.1.2 1.1.1.263 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842289 |
Trichome-related Gene from Literature | N/A |