Detail of EST/Unigene BI269104 |
Acc. | BI269104 |
Internal Acc. | NF008A01IR1F1004 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 13, chloroplastic OS=Solanum lycopersicum E-value=4e-56; Chlorophyll a-b binding protein of LHCII type III, chloroplastic OS=Hordeum vulgare E-value=2e-53; Chlorophyll a-b binding protein of LHCII type I, chloroplastic OS=Lemna gibba E-value=3e-35; Chlorophyll a-b binding protein 36, chloroplastic OS=Nicotiana tabacum E-value=6e-35; Chlorophyll a-b binding protein 4, chloroplastic OS=Solanum lycopersicum E-value=1e-34; |
Length | 348 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA; |
Sequence | CTGGTTTATCTGCTGATCCAGAAGCATTTGCCAAGAACAGGGCTCTTGAGGTGATCCATG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835515 |
Trichome-related Gene from Literature | N/A |