| Detail of EST/Unigene BI269277 |
| Acc. | BI269277 |
| Internal Acc. | NF006E08IR1F1066 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glycerol-3-phosphate acyltransferase, chloroplastic OS=Pisum sativum E-value=2e-47; Glycerol-3-phosphate acyltransferase, chloroplastic OS=Phaseolus vulgaris E-value=1e-42; Glycerol-3-phosphate acyltransferase, chloroplastic OS=Carthamus tinctorius E-value=4e-39; Glycerol-3-phosphate acyltransferase, chloroplastic OS=Arabidopsis thaliana E-value=7e-37; Glycerol-3-phosphate acyltransferase, chloroplastic OS=Spinacia oleracea E-value=2e-34; |
| Length | 677 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SIRRA; |
| Sequence | TCATATCTATCCTATGGCAATACTGTGCCATGACATAATGCCCCCTCCACTAAAGGTTGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 840112 |
| Trichome-related Gene from Literature | N/A |