Detail of EST/Unigene BI269277 |
Acc. | BI269277 |
Internal Acc. | NF006E08IR1F1066 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glycerol-3-phosphate acyltransferase, chloroplastic OS=Pisum sativum E-value=2e-47; Glycerol-3-phosphate acyltransferase, chloroplastic OS=Phaseolus vulgaris E-value=1e-42; Glycerol-3-phosphate acyltransferase, chloroplastic OS=Carthamus tinctorius E-value=4e-39; Glycerol-3-phosphate acyltransferase, chloroplastic OS=Arabidopsis thaliana E-value=7e-37; Glycerol-3-phosphate acyltransferase, chloroplastic OS=Spinacia oleracea E-value=2e-34; |
Length | 677 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA; |
Sequence | TCATATCTATCCTATGGCAATACTGTGCCATGACATAATGCCCCCTCCACTAAAGGTTGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840112 |
Trichome-related Gene from Literature | N/A |