Detail of EST/Unigene BI269308 |
Acc. | BI269308 |
Internal Acc. | NF007C04IR1F1033 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Malate synthase, glyoxysomal (Fragment) OS=Glycine max E-value=1e-87; Malate synthase, glyoxysomal OS=Cucumis sativus E-value=7e-87; Malate synthase, glyoxysomal OS=Cucurbita maxima E-value=2e-85; Malate synthase, glyoxysomal OS=Ricinus communis E-value=2e-83; Malate synthase, glyoxysomal OS=Brassica napus E-value=3e-81; |
Length | 518 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA; |
Sequence | GGAACATGGGCAGCACACCCTGGTCTAATACCATCCTGTATGGAAATTTTCAACAACAAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 831690 |
Trichome-related Gene from Literature | N/A |