| Detail of EST/Unigene BI269308 |
| Acc. | BI269308 |
| Internal Acc. | NF007C04IR1F1033 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Malate synthase, glyoxysomal (Fragment) OS=Glycine max E-value=1e-87; Malate synthase, glyoxysomal OS=Cucumis sativus E-value=7e-87; Malate synthase, glyoxysomal OS=Cucurbita maxima E-value=2e-85; Malate synthase, glyoxysomal OS=Ricinus communis E-value=2e-83; Malate synthase, glyoxysomal OS=Brassica napus E-value=3e-81; |
| Length | 518 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SIRRA; |
| Sequence | GGAACATGGGCAGCACACCCTGGTCTAATACCATCCTGTATGGAAATTTTCAACAACAAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 831690 |
| Trichome-related Gene from Literature | N/A |