Detail of EST/Unigene BI269568 |
Acc. | BI269568 |
Internal Acc. | NF005C01IR1F1005 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein CP26, chloroplastic OS=Arabidopsis thaliana E-value=7e-47; Chlorophyll a-b binding protein of LHCII type I, chloroplastic OS=Lemna gibba E-value=6e-22; Chlorophyll a-b binding protein 151, chloroplastic OS=Gossypium hirsutum E-value=6e-22; Chlorophyll a-b binding protein of LHCII type I, chloroplastic OS=Dunaliella tertiolecta E-value=1e-21; Chlorophyll a-b binding protein 25, chloroplastic OS=Petunia sp. E-value=1e-21; |
Length | 347 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA; |
Sequence | CTGAGATCCCTGAGTACTTGACTGGAGAAGTCCCTGGAGACTACGGTTATGATCCTTTTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826626 |
Trichome-related Gene from Literature | N/A |