Detail of EST/Unigene BI269655 |
Acc. | BI269655 |
Internal Acc. | NF012G01IR1F1007 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Monodehydroascorbate reductase OS=Pisum sativum E-value=7e-23; Monodehydroascorbate reductase OS=Solanum lycopersicum E-value=8e-22; Monodehydroascorbate reductase, seedling isozyme OS=Cucumis sativus E-value=4e-21; Probable monodehydroascorbate reductase, cytoplasmic isoform 4 OS=Arabidopsis thaliana E-value=8e-21; Probable monodehydroascorbate reductase, cytoplasmic isoform 3 OS=Arabidopsis thaliana E-value=1e-20; |
Length | 169 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA; |
Sequence | AAGGCCTCAAATATCCCTATTTAAAGGGCAGGTTGAAGAGGAGAAGGGTGGAATCAAGAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 831774 |
Trichome-related Gene from Literature | N/A |