| Detail of EST/Unigene BI269655 |
| Acc. | BI269655 |
| Internal Acc. | NF012G01IR1F1007 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Monodehydroascorbate reductase OS=Pisum sativum E-value=7e-23; Monodehydroascorbate reductase OS=Solanum lycopersicum E-value=8e-22; Monodehydroascorbate reductase, seedling isozyme OS=Cucumis sativus E-value=4e-21; Probable monodehydroascorbate reductase, cytoplasmic isoform 4 OS=Arabidopsis thaliana E-value=8e-21; Probable monodehydroascorbate reductase, cytoplasmic isoform 3 OS=Arabidopsis thaliana E-value=1e-20; |
| Length | 169 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SIRRA; |
| Sequence | AAGGCCTCAAATATCCCTATTTAAAGGGCAGGTTGAAGAGGAGAAGGGTGGAATCAAGAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 831774 |
| Trichome-related Gene from Literature | N/A |