Detail of EST/Unigene BI269810 |
Acc. | BI269810 |
Internal Acc. | NF008F08IR1F1074 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Protochlorophyllide reductase, chloroplastic OS=Pisum sativum E-value=5e-38; Protochlorophyllide reductase A, chloroplastic OS=Arabidopsis thaliana E-value=5e-38; Protochlorophyllide reductase, chloroplastic OS=Daucus carota E-value=4e-37; Protochlorophyllide reductase B, chloroplastic OS=Arabidopsis thaliana E-value=4e-37; Protochlorophyllide reductase B, chloroplastic OS=Hordeum vulgare E-value=2e-36; |
Length | 438 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA; |
Sequence | CTTGTTCAGAACTCTATTCCCTCCATTCCAGAAGTACATCACCAAAGGCTACGTCTCAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835507 |
Trichome-related Gene from Literature | N/A |