Detail of EST/Unigene BI269837 |
Acc. | BI269837 |
Internal Acc. | NF009G12IR1F1099 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome b6-f complex iron-sulfur subunit, chloroplastic OS=Pisum sativum E-value=1e-18; Cytochrome b6-f complex iron-sulfur subunit, chloroplastic OS=Volvox carteri E-value=4e-16; Cytochrome b6-f complex iron-sulfur subunit, chloroplastic OS=Chlamydomonas reinhardtii E-value=5e-16; Cytochrome b6-f complex iron-sulfur subunit, chloroplastic OS=Spinacia oleracea E-value=2e-15; Cytochrome b6-f complex iron-sulfur subunit 2, chloroplastic OS=Nicotiana tabacum E-value=6e-14; |
Length | 243 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA; |
Sequence | ATTAAAGGGTGATCCTACCTATCTTGTGGTANAGAGTGACAGAACACGTTGCAACATTTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.10.2.2 |
Transcription Factor Family | |
Transporter Classification Family | 3.D.3 Proton-translocating quinol-cyt c reductase superfamily QCR |
Probeset |
|
Corresponding NCBI Gene | 827996 |
Trichome-related Gene from Literature | N/A |