| Detail of EST/Unigene BI269837 |
| Acc. | BI269837 |
| Internal Acc. | NF009G12IR1F1099 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome b6-f complex iron-sulfur subunit, chloroplastic OS=Pisum sativum E-value=1e-18; Cytochrome b6-f complex iron-sulfur subunit, chloroplastic OS=Volvox carteri E-value=4e-16; Cytochrome b6-f complex iron-sulfur subunit, chloroplastic OS=Chlamydomonas reinhardtii E-value=5e-16; Cytochrome b6-f complex iron-sulfur subunit, chloroplastic OS=Spinacia oleracea E-value=2e-15; Cytochrome b6-f complex iron-sulfur subunit 2, chloroplastic OS=Nicotiana tabacum E-value=6e-14; |
| Length | 243 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SIRRA; |
| Sequence | ATTAAAGGGTGATCCTACCTATCTTGTGGTANAGAGTGACAGAACACGTTGCAACATTTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 1.10.2.2 |
| Transcription Factor Family | |
| Transporter Classification Family | 3.D.3 Proton-translocating quinol-cyt c reductase superfamily QCR |
| Probeset |
|
| Corresponding NCBI Gene | 827996 |
| Trichome-related Gene from Literature | N/A |