Detail of EST/Unigene BI269882 |
Acc. | BI269882 |
Internal Acc. | NF012H11IR1F1095 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 1, chloroplastic OS=Pisum sativum E-value=0; Oxygen-evolving enhancer protein 1, chloroplastic OS=Nicotiana tabacum E-value=4e-98; Oxygen-evolving enhancer protein 1, chloroplastic OS=Spinacia oleracea E-value=8e-97; Oxygen-evolving enhancer protein 1, chloroplastic OS=Solanum lycopersicum E-value=2e-96; Oxygen-evolving enhancer protein 1, chloroplastic OS=Fritillaria agrestis E-value=6e-92; |
Length | 674 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA; |
Sequence | TGGAGGAGTANACTCATTCTCCTTCAAACCAGGAAAATACAACGCCAAGAAATTCTGCCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824246 |
Trichome-related Gene from Literature | N/A |