Detail of EST/Unigene BI270388 |
Acc. | BI270388 |
Internal Acc. | NF008C06FL1F1050 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Putative branched-chain-amino-acid aminotransferase 7 OS=Arabidopsis thaliana E-value=7e-50; Branched-chain-amino-acid aminotransferase 2, chloroplastic OS=Arabidopsis thaliana E-value=1e-48; Branched-chain-amino-acid aminotransferase 6 OS=Arabidopsis thaliana E-value=1e-48; Branched-chain-amino-acid aminotransferase 1, mitochondrial OS=Arabidopsis thaliana E-value=2e-48; Branched-chain-amino-acid aminotransferase 3, chloroplastic OS=Arabidopsis thaliana E-value=1e-47; |
Length | 672 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER (1 ESTs); |
Sequence | AGCAACATTTACAAGGGACAAACATCAGCCTTGAATTTGTTGATTAATGAAAACTTTCCT |
EST members of Unigene | BI270388 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00290 Valine, leucine and isoleucine biosynthesis > K00826 branched-chain amino acid aminotransferase; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K00826 branched-chain amino acid aminotransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00770 Pantothenate and CoA biosynthesis > K00826 branched-chain amino acid aminotransferase |
EC | 2.6.1.42 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.6122.1.S1_at
|
Corresponding NCBI Gene | 841432 |
Trichome-related Gene from Literature | N/A |