Detail of EST/Unigene BI271514 |
Acc. | BI271514 |
Internal Acc. | NF057B08FL1F1073 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Zeaxanthin epoxidase, chloroplastic OS=Prunus armeniaca E-value=3e-89; Zeaxanthin epoxidase, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-85; Zeaxanthin epoxidase, chloroplastic OS=Nicotiana plumbaginifolia E-value=1e-82; Zeaxanthin epoxidase, chloroplastic OS=Capsicum annuum E-value=5e-82; Zeaxanthin epoxidase, chloroplastic OS=Arabidopsis thaliana E-value=6e-82; |
Length | 653 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER (1 ESTs); |
Sequence | GGAAAGGTTACTGAAGATATTTGAGGGGTGGTGTGATAATGCAATAGATTTGATAGTTGC |
EST members of Unigene | BI271514 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.33852.1.S1_at
|
Corresponding NCBI Gene | 836838 |
Trichome-related Gene from Literature | N/A |