| Detail of EST/Unigene BI272165 |
| Acc. | BI272165 |
| Internal Acc. | NF020E05FL1F1038 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Beta-amylase 3, chloroplastic OS=Arabidopsis thaliana E-value=9e-35; Beta-amylase 1, chloroplastic OS=Arabidopsis thaliana E-value=6e-34; Beta-amylase 2, chloroplastic OS=Arabidopsis thaliana E-value=5e-25; Inactive beta-amylase 4, chloroplastic OS=Arabidopsis thaliana E-value=3e-24; Beta-amylase 6 OS=Arabidopsis thaliana E-value=4e-24; |
| Length | 478 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DFLOWER (1 ESTs); |
| Sequence | GGCACTGGAAGTTTGACGAAAAATCCTGAGCCGTTCTGAATTCTTTAGAAACGAGGGTGG |
| EST members of Unigene | BI272165 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.33882.1.S1_at
|
| Corresponding NCBI Gene | 827419 |
| Trichome-related Gene from Literature | N/A |