Detail of EST/Unigene BI272165 |
Acc. | BI272165 |
Internal Acc. | NF020E05FL1F1038 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-amylase 3, chloroplastic OS=Arabidopsis thaliana E-value=9e-35; Beta-amylase 1, chloroplastic OS=Arabidopsis thaliana E-value=6e-34; Beta-amylase 2, chloroplastic OS=Arabidopsis thaliana E-value=5e-25; Inactive beta-amylase 4, chloroplastic OS=Arabidopsis thaliana E-value=3e-24; Beta-amylase 6 OS=Arabidopsis thaliana E-value=4e-24; |
Length | 478 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER (1 ESTs); |
Sequence | GGCACTGGAAGTTTGACGAAAAATCCTGAGCCGTTCTGAATTCTTTAGAAACGAGGGTGG |
EST members of Unigene | BI272165 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.33882.1.S1_at
|
Corresponding NCBI Gene | 827419 |
Trichome-related Gene from Literature | N/A |