Detail of EST/Unigene BI307924 |
Acc. | BI307924 |
Internal Acc. | EST529334 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | GDP-mannose 3,5-epimerase 2 OS=Oryza sativa subsp. japonica E-value=2e-66; GDP-mannose 3,5-epimerase 1 OS=Oryza sativa subsp. japonica E-value=1e-65; GDP-mannose 3,5-epimerase 1 OS=Oryza sativa subsp. indica E-value=1e-65; GDP-mannose 3,5-epimerase OS=Arabidopsis thaliana E-value=3e-64; |
Length | 445 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GPOD; |
Sequence | GCATTGGGAGGTTCCATAACATATATGGTCCTTTTGGAACATGGAAAGGTGGAAGGGAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 4.1.1.35 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 833002 |
Trichome-related Gene from Literature | N/A |