Detail of EST/Unigene BI307966 |
Acc. | BI307966 |
Internal Acc. | EST529376 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | UDP-glucuronic acid decarboxylase 1 OS=Rattus norvegicus E-value=6e-11; UDP-glucuronic acid decarboxylase 1 OS=Pongo abelii E-value=6e-11; UDP-glucuronic acid decarboxylase 1 OS=Mus musculus E-value=6e-11; UDP-glucuronic acid decarboxylase 1 OS=Homo sapiens E-value=6e-11; UDP-glucuronic acid decarboxylase 1 OS=Xenopus tropicalis E-value=4e-10; |
Length | 638 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GPOD; |
Sequence | CAACTCAATGTAACATTTCCAATAGGAGAAATTGGATAGAAAAATAAGAGAAAACACTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Carbohydrate Metabolism > ko00520 Nucleotide sugars metabolism > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko01055 Biosynthesis of vancomycin group antibiotics > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko00523 Polyketide sugar unit biosynthesis > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Carbohydrate Metabolism > ko00520 Nucleotide sugars metabolism > K08678 UDP-glucuronate decarboxylase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K08678 UDP-glucuronate decarboxylase |
EC | 4.1.1.35 4.2.1.46 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836047 |
Trichome-related Gene from Literature | N/A |