Detail of EST/Unigene BI308009 |
Acc. | BI308009 |
Internal Acc. | EST529419 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | MOSC domain-containing protein 2, mitochondrial OS=Bos taurus E-value=5e-22; MOSC domain-containing protein 2, mitochondrial OS=Macaca fascicularis E-value=8e-18; MOSC domain-containing protein 2, mitochondrial OS=Rattus norvegicus E-value=3e-16; MOSC domain-containing protein 2, mitochondrial OS=Mus musculus E-value=2e-15; MOSC domain-containing protein 1, mitochondrial OS=Homo sapiens E-value=1e-14; |
Length | 728 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GPOD; |
Sequence | TTTCTAACAATGGGTGCTGCACCATCAACTTCAATAGCTGAAGCTAAAATTTCAGCCATT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839975 |
Trichome-related Gene from Literature | N/A |