| Detail of EST/Unigene BI308009 |
| Acc. | BI308009 |
| Internal Acc. | EST529419 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | MOSC domain-containing protein 2, mitochondrial OS=Bos taurus E-value=5e-22; MOSC domain-containing protein 2, mitochondrial OS=Macaca fascicularis E-value=8e-18; MOSC domain-containing protein 2, mitochondrial OS=Rattus norvegicus E-value=3e-16; MOSC domain-containing protein 2, mitochondrial OS=Mus musculus E-value=2e-15; MOSC domain-containing protein 1, mitochondrial OS=Homo sapiens E-value=1e-14; |
| Length | 728 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GPOD; |
| Sequence | TTTCTAACAATGGGTGCTGCACCATCAACTTCAATAGCTGAAGCTAAAATTTCAGCCATT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839975 |
| Trichome-related Gene from Literature | N/A |