Detail of EST/Unigene BI308196 |
Acc. | BI308196 |
Internal Acc. | EST529606 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Granule-bound starch synthase 1, chloroplastic/amyloplastic OS=Pisum sativum E-value=0; Granule-bound starch synthase 1, chloroplastic/amyloplastic OS=Antirrhinum majus E-value=0; Granule-bound starch synthase 1, chloroplastic/amyloplastic OS=Solanum tuberosum E-value=0; Granule-bound starch synthase 1, chloroplastic/amyloplastic OS=Manihot esculenta E-value=0; Granule-bound starch synthase 1, chloroplastic/amyloplastic OS=Ipomoea batatas E-value=0; |
Length | 700 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GPOD; |
Sequence | GGTTATGATCAATACAAGGGATGCATGGGATACTGATGTATCTGTTGAGCTCAAAGTTGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840184 |
Trichome-related Gene from Literature | N/A |