| Detail of EST/Unigene BI308239 |
| Acc. | BI308239 |
| Internal Acc. | EST529639 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 89A9 OS=Arabidopsis thaliana E-value=5e-43; Cytochrome P450 89A2 OS=Arabidopsis thaliana E-value=1e-39; Cytochrome P450 77A1 (Fragment) OS=Solanum melongena E-value=3e-24; Cytochrome P450 77A4 OS=Arabidopsis thaliana E-value=5e-23; Cytochrome P450 77A3 OS=Glycine max E-value=1e-22; |
| Length | 780 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GPOD; |
| Sequence | GGTTTTGTGTCACACACATAAATTCTTCCCCACAAAAAAGTAAAGTTGCACCAAACATTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00513 cytochrome P450, family 21, subfamily A (steroid 21-monooxygenase); Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07422 cytochrome P450, family 2, subfamily U |
| EC | 1.14.99.9 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 815688 |
| Trichome-related Gene from Literature | N/A |