| Detail of EST/Unigene BI308317 |
| Acc. | BI308317 |
| Internal Acc. | EST529727 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ubiquinone biosynthesis protein COQ9, mitochondrial OS=Xenopus tropicalis E-value=4e-22; Ubiquinone biosynthesis protein COQ9-A, mitochondrial OS=Xenopus laevis E-value=4e-21; Ubiquinone biosynthesis protein COQ9-B, mitochondrial OS=Xenopus laevis E-value=5e-21; Ubiquinone biosynthesis protein COQ9, mitochondrial OS=Rattus norvegicus E-value=2e-20; Ubiquinone biosynthesis protein COQ9, mitochondrial OS=Mus musculus E-value=2e-20; |
| Length | 749 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GPOD; |
| Sequence | GTTCAACGGAAACGCTGCACTCCGGTTCCGGCGTCATAATGCATTGATAACTTATTCTCG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 838497 |
| Trichome-related Gene from Literature | N/A |