| Detail of EST/Unigene BI308336 |
| Acc. | BI308336 |
| Internal Acc. | EST529746 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Elongation factor Tu, chloroplastic OS=Pisum sativum E-value=9e-97; Elongation factor Tu, chloroplastic OS=Arabidopsis thaliana E-value=2e-93; Elongation factor Tu, chloroplastic OS=Glycine max E-value=6e-93; Elongation factor Tu, chloroplastic OS=Glycine max E-value=4e-92; Elongation factor TuB, chloroplastic OS=Nicotiana sylvestris E-value=3e-91; |
| Length | 730 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GPOD; |
| Sequence | ACTATATACCAATCCCTCAAAGACAAACGGAACTCCCCTTTTTGCTAGCTATTGAGGATG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 3.6.5.3 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827784 |
| Trichome-related Gene from Literature | N/A |